Transapient Musings of an S6 Archailect
Hey there, my name is Bryan Bishop. Here's to trying to keep up with yourself. RSS.
   

About
Transapient Musings of an S6 Archailect

Metacognitive trivialities over smooth topologies and Julian knots of subgeometric spaces; a.k.a mastermind Singularitarian, node of the Larger Submind and Clone of the Ineffable Original.

Bryan Bishop
http://heybryan.org/
email: kanzure@gmail.com
AIM: kanzure
ICQ: kanzure
YIM: kanzure
Skype: kanzure
Jabber/G-talk: kanzure@gmail.com
MSNM: cm007x2@yahoo.com
IRC: irc.freenode.net (#hplusroadmap)
phone: #1-512-203-0507


Archives

       

Wed, 23 Apr 2008

Learning python design patterns via vids
Over here. I needed an adapter design pattern, and the crew in #python were quite helpful, especially pkrumins.

posted at: 22:33 | path: /software | permanent link to this entry

Mon, 21 Apr 2008

Getting your institution supported
src

More and more people have been asking us how to get their institution supported, so we thought we'd explain a bit more.

As you know, Pubget makes it easy for users to retrieve and navigate full-text articles, most commonly in PDF form. Where access to these articles is free, Pubget displays PDFs for free. But where access is restricted by subscription, Pubget displays only abstracts; to display the full text of that material, Pubget must support the subscribing institution.

In general, support is a paid service, with the cost paid not by the end-user but by the subscribing institution. The cost depends on three factors: (1) the size of your institution's subscription holdings, (2) the setup of its bioinformatics infrastructure, and (3) the suite of features your institution is looking for.

Because Pubget's mission is to make search ever quicker, easier, and more powerful, we are also interested in novel pilot projects; these may modify the above paid arrangements.

Finally, we're mindful of the unique requirements of supporting commercial institutions, like pharmaceutical companies, with enterprise-level solutions, and also of supporting institutions in Europe, the Far East, South Asia, and elsewhere (we have experience setting up enterprise-level solutions on four continents).

We've put this info up on the site here (you can also get to it by clicking "Contact" at the top of the page). To find out more, if you're a librarian, administrator, or other executive, please go there and take a moment to tell us a bit about yourself, your institution and its holdings, and what you're looking for, and we'll get back to you soon with more details about how to get Pubget supported at your institution. And thanks again for your interest!

posted at: 18:49 | path: | permanent link to this entry

Can't get a paper? Here's what you do
src

Here at Pubget we get feedback every now and again from people who are sure they have access to a paper, but aren't able to see it. For example they'll do a search and one of the results will be a paper from Nature from 2004, and they're sure they have access to that, but instead all they see is (1) an abstract, (2) a cheery page that says to try the little "retry" button on the upper right, (3) a less cheery page from the publisher's website saying there was some kind of error, or, rarely, (4) the dreaded "404 Not Found" message. And they send us feedback asking what to do.

Well, here's what you do.

The first thing to try is the little "retry" button at the upper right. If you click that it'll flash for a second, and then about a second later the page will refresh. Nine times out of ten it'll refresh with your PDF; most of the rest of the time it'll give you back an abstract (read on). Why does this happen? Sometimes there's just no link yet; either the paper was just published, or else came out way back in like 1947. Other times papers get moved from somewhere proprietary to somewhere else (most often an open-access archive), and every so often that throws Pubget for a loop. Usually we realize it and so present to you that cheery page that says to try the retry button, but on those rare occasions that we don't, just know to try the retry button. This almost always fixes things (especially the dreaded "404 Not Found" message).

What if it doesn't fix things? Usually when it doesn't fix things, what you see is the abstract. What that means is Pubget has checked and is pretty sure it doesn't have access to that PDF. Sometimes we're wrong about that. For example, just recently Pubget thought that Harvard didn't have access to a journal called Cell Cycle, when in fact it did. You'll notice that after you try the "retry" button, it changes into a button that says "still a problem?" We've got error checking on our end that usually catches these things, but if there's still a problem, just click the "still a problem?" button and send us a quick note. And here's something important: please remember to include an email address, so we can get back to you! Otherwise, we've got no way of getting back to you to let you know we've fixed the problem (which we can generally do pretty fast).

Which reminds me: whoever-you-are, you'll be glad to know Cell Cycle at Harvard is fixed.

The other thing that can go wrong is there's a bad link somewhere. There are 20 million records out there, and while publishers usually do a pretty amazing job of making sure all the links work, every so often they don't. Sometimes we can provide a workaround, but only if you let us know. So thanks for letting us know!

posted at: 18:49 | path: | permanent link to this entry

Pubget on YouTube
src

Funny thing we've noticed about Pubget. You tell people "It's like Pubmed, except you get the PDFs right away." But then some people say, "Sounds nice, but I can already get PDFs right away. I can click really fast." And you're not quite sure what to say to that. It's like it's 100 years ago and you're pitching the idea of using the airplane to cross the Atlantic and someone says, "Sounds nice, but we've already got a really fast boat."

The only thing you can do is show them. And short of them visiting Pubget at www.pubget.com and clicking under where it says "Try it!" we figured the best thing was a movie. And so here we are on YouTube, so you can see what we mean.



The only thing to note is that this was on a computer where the user was already logged in to a supported institution (more on how to get your institution supported in another post), so there's no login prompt, and all the PDFs are available. If you try this search—it was "kirschner mw[au]", in case you can't read it—without institutional access, you still get about half the PDFs, but not, say the ones from Nature. But hopefully this little clip is enough to illustrate the problem, and how Pubget is the solution.

posted at: 18:49 | path: | permanent link to this entry

Sun, 20 Apr 2008

Five Cutting Edge Microrobotics Labs
src

Microrobotics is a futuristic field dealing with the construction of extremely small actuators, sensors, support structures, computers, and robots. Let’s take a look at some of the best labs, their greatest accomplishments, and future plans.


1. Automation and Robotics Research Institute, University of Texas at Arlington

The research page summarizes their focus as follows:

“Much of AARI’s research revolves around smart micromachines which can emulate human functions, such as, perception, cognition, motion, communication, and interaction with the environment, humans, and among themselves.”

Their page includes a graphic that shows their three main focus areas: micromanufacturing, smart micromachines, and next-generation robotics. From the microrobotics page, their objective is stated as:

“Cost effective precision assembly of heterogeneous micro and nano systems. At high assembly yields, this technology is a viable alternative to monolithic fabrication. MEMS microrobots are also a viable top-down pathway to nanomanufacturing.

Two-prong approach based on:

* A meso-micro-nano assembly platform for MEMS millimeter to micron part sizes and nanometer tolerances. This platform uses microrobots built on a wafer.
* A micro-nano assembly system built using these microrobots.”

This is notable for mentioning nanomanufacturing by name. It also shows a commitment to aggressively pursue the microbots-that-build-microbots milestone. A microbot that could build another microbot using specially-supplied raw materials would be extremely useful. Because microbots are so small and require so little energy, they could be constructed in very large numbers if the process of their fabrication could be automated or streamlined. Research like this could eventually lead to microbots that can build other microbots just by using silicon or carbon from the ground.

Some of the innovative research directions or accomplishments at AARI include tiny windmills, vibration energy harvesters, in vivo medical micro-sensors, micropumps, microspectrometer, piezoactuators, mobile sensor networks, microrobotic-embedded textiles, 3D micromachine packaging, and more.

Definitely a lab to keep an eye on. Their research summary promises a lot, but will they be able to deliver? Only time will tell.

2. Donald Lab at Duke University

This lab is mainly famous for the tiny, 2D microbot pictured above, created by the facility’s namesake, Bruce Donald, and co-workers. According to the site, the microbot has “dimensions of 60 µm by 250 µm by 10 µm. This micro-robot is 1 to 2 orders of magnitude smaller in size than previous micro-robotic systems. The device consists of a curved, cantilevered steering arm, mounted on an untethered scratch drive actuator. These two components are fabricated monolithically from the same sheet of conductive polysilicon, and receive a common power and control signal through a capacitive coupling with an underlying electrical grid.”

Pretty nifty! This is about as small as true robots have gotten so far, just a few hundred times the volume of a typical red blood cell. A flea could accidentally step on this thing and crush it! More info on Dr. Donald’s microbot:

“He likens it to a car, because it’s controllable: “You can steer it anywhere on a flat surface, and drive it wherever you want to go.” Unlike previous attempts at such a microelectromechanical system, Donald’s robot has no tether, but operates via electrical charges on a silicon grid. It’s a real speed demon, proceeding in nano-sized hops (one billionth of a meter, 20,000 times per second), ultimately achieving two millimeters per second, or the equivalent on a more human scale of 80 kilometers per hour. To the tunes of a Strauss waltz, Donald demonstrates two robots dancing in straight and wavy lines around each other, and then coupling to form a single system.”

On the research page for microrobotics we see this summary:

“The goal of this research is to build microsystems that can actively, accurately, and efficiently interact and change the physical world. While so far MEMS research has been biased more towards sensor technology, there are a large number of potential applications that require micro actuators. Important examples are techniques to efficiently move, sort, or mix small particles (e.g. cells in biotechnology applications); or micro positioning devices for inspection and assembly of complex micro systems (e.g. for display or amplifier arrays).”

Numerous papers and preprints are available at the site. Also interesting is a paper that includes a design for artificial flagella. Microrobotics researchers are progressively creating artificial systems that match all the capacities of a bacterium. After that is done, creating artificial eukaryote-like cells will be next.

All in all, looks like a great lab, although the web page needs to do better to portray all the research that is being done in the papers. Press coverage is available here, it mostly focuses on the aforementioned micro-bot. This microbot was an amazing accomplishment, can’t wait to see the follow-ups.

3. Harvard Microrobotics Lab

From the home page:

“Our research focuses on all aspects of mobile microrobot design, fabrication, control, and analysis. Expertise in microfabrication and microsystem design combined with insights from nature enable us to create high-performance microrobots for aerial, terrestrial, and aquatic environments. Such systems can be used for search and rescue, hazardous environment exploration, environmental monitoring, and reconnaissance.”

This lab created a splash last summer when they launched their 60-mg fly microrobot with a wingspan of about an inch. As far as I know, this is the smallest flying machine built by man. I wouldn’t be surprised if these were deployed offensively in warfare as early as 2015. Imagine one equipped with a tiny hypodermic needle and a microgram of botulism toxin, enough to kill about a hundred humans. What if you could assassinate a political figure with one of these and never be caught? It would change geopolitics entirely.

The research overview points to three research areas: biomimetic mobile microrobots, control for autonomous robots and emergent swarm behaviors, and smart materials, microactuators, and soft robotics. Breaking it down, these include the fly robot, tiny walker robots based on arthropods, an aquatic robot based on minnows, micro air vehicles for inside use, operant conditioning for teaching complex behaviors, swarm robotics, artificial muscles, morphable mobile robots, self-reconfigurable robotics and objects, and novel sensor suites.

This lab is distinct for pursuing all three major types of locomotion: swimming, walking, and flying. For microrobotics, copying the design of nature is a great idea: fairyflies, for example, are wasps with a diameter in the neighborhood of 140 microns, over a hundred times smaller than the fly bot. It may be a while before we create flying robots so small that they’re invisible, but if this research continues, it will only be a matter of time.

4. Nanorobotics Lab at Carnegie Mellon

This lab actually calls itself a nanorobotics lab rather than a microrobotics lab, although it’s basically the same thing as the others. Various interesting projects are being explored here, including gecko-inspired wall-climbing robots, lizard-inspired water-running robot, water strider robot, magnetically actuated micro-robots, microscopic swimming robots, and endoscopic micro-capsules for medical uses.

It almost seems like this lab and the Harvard Lab are trying not to walk on each other’s toes, because they are collectively trying to reproduce most forms of animal locomotion in their microbot research, while not working on what the other is. If you put their robots together, they’d be invincible — flying, crawling, walking, water-striding, wall-climbing, and swimming! All they need next is the burrowing microbot.

My favorite is the swimming robot. It exploits the motility of bacterial flagella by attaching a small colony of them to the back of a submarine-shaped microbot. This circumvents the usual challenge of trying to separate the flagella from the bacteria before using it. The motor even includes an off-on switch, which uses copper ions to stop the motor, and ethylenediaminetetraacetic acid (EDTA) to resume it. The possible applications are listed as delivering drugs to hard-to-reach, specific areas of the human body and aiding in diagnosis. Eventually, robots like this might also be helpful for nanomedicine style surgery, such as removing fat cells or reinforcing muscle fibers. Maybe, at an advanced stage, they could even add in new brain cells, providing a path to human intelligence enhancement.

5. Biomimetic Millisystems Lab at Berkeley

This lab describes its research goal as follows:

“The goal of the Biomimetic Millisystems Lab is to harness features of animal manipulation, locomotion, sensing, actuation, mechanics, dynamics, and control strategies to radically improve millirobot capabilities. Research in the lab ranges from fundamental understanding of mechanical principles to novel fabrication techniques to system integration of autonomous millirobots. The lab works closely with biologists to develop models of function which can be tested on engineered and natural systems. The lab’s current research is centered on fly-size flapping flight, and all-terrain crawling using nanostructured adhesives.”

Another microrobotics lab, another name for the same thing. This Berkeley lab works on some of the same projects as the others, including a fly microbot weighing less than 100 milligrams and with a wingspan of an inch, self-cleaning synthetic gecko-adhesives (check out some of the images on that page), and microassembly (microbots building each other again).

What really makes the Berkeley lab stand out from the others is their attempt to develop a desktop rapid prototyping toolkit for under $1000 to build microbots from composite fiber. Besides making microbots available to anyone, a desktop prototype machine would help with the automated assembly of microscale parts, something currently laborious. The system has already been used to fabricate several simple microstructures, including a microscale wrist and 4-bar mechanism. Soon: microbots for the people!

That concludes my summary. If you want to read further interesting futurist articles and discussion, subscribe to the feed.



posted at: 16:36 | path: /sci/nano | permanent link to this entry

Engineers make first 'active matrix' display using nanowires
src

Purdue University researchers have created the first active-matrix display using a new class of transparent nanowire transistors and circuits. Future applications include e-paper, flexible color monitors, and heads-up displays embedded in car windshields. (Source: http://physorg.com/news126202412.html)

posted at: 16:35 | path: /sci/nano | permanent link to this entry

Nano-Softball Made of DNA
src

Ruhr University scientists have created a dodecahedron (a geometric shape with twelve surfaces) from DNA building blocks. The 20-nanometer particles were self-assembled from 20 trisoligonucleotide building blocks, consisting of a "branching junction" and three short DNA strands. Additional functional molecules can be attached, allowing for highly complex nanoconstructions resembling viruses in shape and size. Potential applications include medical diagnostics to nanoelectronics. (Source: http://physorg.com/news126243441.html)

posted at: 16:34 | path: /sci/nano | permanent link to this entry

Graphene gazing gives glimpse of foundations of universe
src

University of Manchester researchers have found that graphene, the world's thinnest material (a one-atom-thick gauze of carbon atoms), absorbs a well-defined fraction of visible light, which allows the direct determination of the fine structure constant (approximately 1/137), which defines the interaction between very fast moving electrical charges and electromagnetic waves. The researchers found the carbon monolayer absorbs 2.3 percent of visible light. The experiments supported by theory show this number divided by Pi gives the exact value of the fine structure constant. (Source: http://www.physorg.com/news126451521.html)

posted at: 16:34 | path: /sci/nano | permanent link to this entry

Stem Cell Advance Yields Over 140 Cell Types
src

A team of North American scientists has unveiled a new technology that could revolutionize the industrialization and commercialization of stem cell therapies. They have found a method to produce 140 cell types from human embryonic progenitor (hEP) cells (partially differentiated cells). Current differentiation protocols are inefficient and result in a mixed population of differentiated cells where the desired cell type is only a few percent of the total. The new method could make cell types in larger quantities than current protocols and with longer telomeres than most fetal- or adult-derived cells. See also large-scale combinatorial cloning of novel human embryonic stem cell derivatives (Source: http://www.medicalnewstoday.com/articles/102604.php)

posted at: 16:33 | path: /sci/bio | permanent link to this entry

Carbon nanotubes made into conductive, flexible 'stained glass'
src

Northwestern University researchers have used metallic nanotubes to make thin films that are semitransparent, highly conductive, flexible and come in a variety of colors, with an appearance similar to stained glass. These results could lead to improved, lower-cost products such as flat-panel displays and solar cells. (Source: http://www.physorg.com/news126956385.html)

posted at: 16:32 | path: /sci/nano | permanent link to this entry

Selling Stem Cells
src

BioTime, a California biotech company headed by Michael West, a prominent scientist and entrepreneur involved in stem cell research, plans to supply scientists working with stem cells the tool they most need to develop and test novel therapies--a reliable and reproducible source of the cells. They plan to sell human embryonic progenitors, cells that have inched partway along the continuum from embryonic stem cell to differentiated adult cell and can reliably generate cells that reproduce only the same type of cells. (Source: http://www.technologyreview.com/Biztech/20533/)

posted at: 16:31 | path: /sci/bio/biotech | permanent link to this entry

How to Make Graphene
src

Rutgers University researchers have developed an easy way to make transparent graphene films that are a few centimeters wide and one to five nanometers thick. (Manish Chhowalla, Rutgers University) Thin films of graphene could provide a cheap replacement for the transparent, conductive indium tin oxide electrodes used in organic solar cells. They could also replace the silicon thin-film transistors common in display screens. Graphene can transport electrons tens of times faster than silicon, so graphene-based transistors could work faster and consume less power. (Source: http://www.technologyreview.com/Nanotech/20558/)

posted at: 16:30 | path: /sci/nano | permanent link to this entry

Researchers create first thermal nanomotor
src

Researchers from the Universitat Autonoma de Barcelona have created the first nanomotor propelled by changes in temperature. The "nanotransporter" consists of a carbon nanotube covered by a shorter concentric nanotube that can move back and forth to transport cargo when heated on one end. Movement can be controlled with a precision of less than the diameter of an atom. Source: Researchers create the first thermal nanomotor in the world (Source: )

posted at: 16:30 | path: /sci/nano | permanent link to this entry

How Social Networking Could Kill Web Search as We Know It
src

With the rise of social networking sites such as Facebook, MySpace, Twitter, Second Life, LinkedIn and even Google's own Orkut, the next generation of Web users may find what they want by using their social network rather than a search algorithm. The logic of search may also flip inside out. Since we are essentially meta-tagging ourselves through our social networking memberships, shopping habits and surfing addictions, it's conceivable that the information could attempt to find us. As new content enters the Web, it could tumble through the various filters that you set up around your identity and then show up on your home-page news feed, or in your in box, or pop up on a ticker that follows you around as you browse from page to page. (Source: http://www.popularmechanics.com/technology/industry/4259135.html)

posted at: 16:30 | path: /social | permanent link to this entry

Of Circles and Solar Cells
src

University of Washington researchers have created "popcorn balls" out of nanometer-sized kernels of light-absorbing material to capture more light on solar collectors by clumping hundreds of minuscule grains into clusters of large grains. (University of Washington) The small grains provide a large surface area for maximum absorption, while the large grains are closer to the wavelength of visible light and so ricochet the light into the smaller grains. (Source: http://www.popsci.com/environment/article/2008-04/circles-and-solar-cells)

posted at: 16:28 | path: /solar | permanent link to this entry

Faster, more sensitive AFM probes extend nanoscale measurements
src

New Georgia Institute of Technology research demonstrates that novel probe technology based on flexible membranes can replace conventional atomic force microscopy (AFM) cantilevers for applications such as fast topographic imaging, quantitative material characterization and single-molecule mechanics measurements. The force sensing integrated readout and active tip (FIRAT) probes also simultaneously measure material properties including adhesion, stiffness, elasticity and viscosity. The new probe replaces the AFM cantilever with a drum-like membrane from which a tip extends to scan the material sample. In one scanning mode, as the tip moves above a surface, it lightly taps the material. With each tap, the instrument gathers precise information about both the tip's position and the forces acting on it, sensing the shape of the material and how stiff and sticky it is. FIRAT probes made of dielectric materials with embedded actuation electrodes have also been designed for operation in liquids. The design of these membrane-based probes also makes them relatively easy to arrange in arrays in which each probe can move independently. One application of such an array is fast parallel measurements of forces between biological molecules. Source: Fast AFM probes measure multiple properties of biomolecules or materials simultaneously (Source: )

posted at: 16:28 | path: /sci/nano | permanent link to this entry

Wireless EEG System Self-powered By Body Heat And Light
src

The Interuniversity Microelectronics Centre, affiliated with the Holst Centre, has developed a wireless 2-channel EEG system powered only by body heat and ambient light. The hybrid power supply combines a thermoelectric generator that uses the heat dissipated from a person's temples and silicon photovoltaic cells. It could be used to monitor brain waves after a head injury. The entire system is wearable and integrated into a device resembling headphones. It can provide an average of more than 1mW indoors. (Source: http://www.sciencedaily.com/releases/2008/04/080412172006.htm)

posted at: 16:28 | path: /sci/bio/neuro | permanent link to this entry

New Artificial Material Paves Way To Improved Electronics
src

University of Liege and University of Geneva scientists have developed a new artificial material based on interface engineering at the atomic scale that promises to open up radically new electronic applications. (University of Liege) The material is a superlattice, with a multilayer structure composed of alternating atomically thin layers of two different oxides (PbTiO3 and SrTiO3). It has properties that are different from either of the two materials--ferroelectricity and a dielectric constant--created by the artificially layered structure and driven by interactions at the atomic scale at the interfaces between the layers. (Source: http://www.sciencedaily.com/releases/2008/04/080415193420.htm)

posted at: 16:27 | path: /nanotech | permanent link to this entry

Revealed: the Asian source of the annual flu epidemic
src

In the biggest analysis of flu strains ever, Cambridge University researchers have shown the annual flu epidemic comes from eastern and southeast Asia, a product of the connectedness of people and the patchiness of the region's rainy seasons. New viruses appeared in eastern and southeast Asia 6 to 9 months before they showed up anywhere else, and took another 6 to 9 months to reach Latin America. The team found that outbreaks follow the cooler temperatures of the rainy seasons, which are staggered in time across the region because of complex geography and air movements. There is always a flu epidemic happening somewhere in east and southeast Asia, they said. Then when the climatic conditions are right in the northern or southern temperate zones, they seed the next winter epidemic, which goes to Europe, Oceania, and North America first. (Source: http://www.newscientist.com/article/dn13724-revealed-the-asian-source-of-the-annual-flu-epidemic.html)

posted at: 16:27 | path: /sci/bio/patho | permanent link to this entry

Atom-thick material runs rings around silicon
src

University of Manchester researchers have used graphene to make some of the smallest transistors ever, at one atom thick and ten atoms wide. credit: MU Mesoscopic Physics Group They found that cutting small quantum dots of graphene gave the material switchable conductivity. Dots just a few nanometers across trap electrons due to quantum effects, and applying a magnetic field to the smallest dots lets current flow again, making a switchable transistor. The smallest dots that worked as transistors contained as few as five carbon rings--around 10 atoms or 1 nm wide. Previous graphene transistors were significantly bigger--ribbons 10 nm across and many times longer. (Source: http://technology.newscientist.com/article/dn13730-atomthick-material-runs-rings-around-silicon.html)

posted at: 16:26 | path: /nanotech | permanent link to this entry

Music Builds Bridges in the Brain
src

Harvard Medical School and Boston College researchers have found that taking music lessons can strengthen connections between the two hemispheres of the brain in children, but only if they practice diligently. For the children who practiced at least 2.5 hours a week, a region of the corpus callosum that connects movement-planning regions on the two sides of the brain grew about 25% relative to the size of the brain. With every child, the researchers found that the size increase in the corpus callosum predicted the improvement on a nonmusical test that required the children to tap out sequences on a computer keyboard. (Source: http://sciencenow.sciencemag.org/cgi/content/full/2008/416/1)

posted at: 16:25 | path: /sci/bio | permanent link to this entry

Zillionics
src

More is different.

Large quantities of something can transform the nature of those somethings. Or as Stalin said, "Quantity has its a quality all its own." Computer scientist J. Storrs Hall, in "Beyond AI", writes:

If there is enough of something, it is possible, indeed not unusual, for it to have properties not exhibited at all in small, isolated examples. The difference [can be] at least a factor of a trillion (10^12). There is no case in our experience where a difference of a factor of a trillion doesn't make a qualitative, as opposed to merely a quantitative, difference. A trillion is essentially the difference in  weight between a dust mite, too small to see and too light to feel, and an elephant. It's the difference between fifty dollars and a year's economic output for the entire human race. It's the difference between the thickness of a business card and the distance from here to the moon.

I call this difference zillionics.

Zillionics

The machinery of duplication, particularly digital duplication, can amplify ordinary quantities of everyday things into orders of abundance previously unknown. Populations can go from 10 to a billion, trillion and zillion range.

Your personal library may expand from 10  books to an all digital 30 million books in the Google Library. Your music collection may go from 100 albums to all the music in the world. Your personal archive may go from a box of old letters to a petabyte of information over your lifetime. A business may need to manage hundreds of petabytes of information per year. Scientists may generate gigabytes of data per second. The number of files a government may need to track, secure, and analyze may reach into the quintrillions.

Zillionics is a new realm, and our new home. The scale of so many moving parts require new tools, new mathematics, new mind shifts.

One Trillion A
For scale, a trillion pennies next to a football field, from the Megapenny project.

When you reach the giga, peta, and exa orders of quantities, strange new powers emerge. You can do things at these scales that would have been impossible before. A zillion hyperlinks will give you information and behavior you could never expect from a hundred or thousand links. A trillion neurons give you a smartness a million won't. A zillion data points will give you insight that a mere hundred thousand would never.

At the same time, the skills needed to manage zillionics are daunting. In this realm probabilities and statistics reign. Our human intuitions are unreliable.

I previously wrote:

We know from mathematics that systems containing very, very large numbers of parts behave significantly different from systems with fewer than a million parts. Zillionics is the state of supreme abundance, of parts in the many millions. The network economy promises zillions of parts, zillions of artifacts, zillions of documents, zillions of bots, zillions of network nodes, zillions of connections, and zillions of combinations. Zillionics is a realm much more at home in biology—where there have been zillions of genes and organisms for a long time—than in our recent manufactured world. Living systems know how to handle zillionics. Our own methods of dealing with zillionic plentitude will mimic biology. (From New Rules for the New Economy, 1998.)

The social web runs in the land of zillionics. Artificial intelligence, data mining, and virtual realities all require mastery of zillionics. As we ramp up the number of things we create, especially the ones we create collectively, we are also raising our media and culture into the realm of zillionics. The number of choices we have for music, art, images, words -- anything! -- is reaching the level of zillionics.

How do we prevent being paralyzed by zillionic choice (see the Paradox of Choice), or bullied by it? Is zillionics unlimited? This is a long tail so long, so wide, so deep, that it becomes something else again entirely.

More is different.



posted at: 16:14 | path: | permanent link to this entry

Hang Out with io9ers at San Francisco's Nerd Salon 4/23 [Nerd Salon]
src

At random intervals, an event called Nerd Salon happens in San Francisco. People meet at a bar, drink, play with robots, and have a chance to solve a puzzle to win something cool (usually alcohol). It's organized by yours truly and Jennifer Granick, a kickass lawyer (and serious comic book geek) from the Electronic Frontier Foundation. A new installment of Nerd Salon is happening next week, just in time for all the web nerds in town for O'Reilly's Web 2.0 Expo, and of course io9 readers are cordially invited. Come out Wed., April 23, 6-9 PM at the Makeout Room in San Francisco. Get drunk and play with bots. And talk about aliens. Or zombies. Whatever.



posted at: 16:00 | path: /conferences | permanent link to this entry

Moonflowers Grow On Lunar Surface With Bacterial Boost [Moon Colony]
src

The first lunar colonists will grow their own vegetables directly in the soil of the moon, while Earthbound romantics will order moonroses for their sweethearts. Researchers now claim that instead of carting tons of Earth soil to the moon for agriculture, moonfarms will use the dirt, rock and dust already present. The secret to growing plants on the seemingly infertile lunar surface? Just add bacteria.


Scientists with the European Space Agency experimented with marigolds grown in crushed anorthosite, an Earth-rock that is a close analogue to the lunar surface. Just potting the flowers in anorthosite was not effective. They didn't grow. But adding certain bacteria made a huge difference. The marigolds didn't exactly flourish in the faux moondirt, but they did grow and even blossomed. The bacteria facilitated the transfer of nutrients from the anorthosite to the plants.

Of course, the area where the plants were grown would need to be domed (they still need air) and watered, but they could be part of a water filtration system or even provide food for a self-sustaining lunar colony. While the ESA has no actual plans to go to the moon anytime soon, some scientists think we could send a robot to plant lunar veggies before the first colonists arrive. Photo by: BBC.

Plants 'thrive' on Moon rock diet [BBC]



posted at: 15:59 | path: /astrotech | permanent link to this entry

Recognize Everyone You've Ever Met With Smart Goggles [Smart Goggles]
src

Smart Goggles will totally revolutionize social interaction. When you meet people, instead of struggling to remember their names and other pertinent details, you'll just file the info with your glasses, which will recognize those people next time and display the stored information. How long will it be before someone programs a pair to come up with Terminator-style instruction lists? Just don't get too snarky about your coworkers in the notes your glasses save about them — they're bound to fall into the wrong hands.

smartgogglesJSH_228x342.jpgSo how do Smart Goggles work? It's pretty simple. You have a camera attached to the front, and a super-powerful tiny computer in back, which scans people and runs them through a face-recognition database. It then pulls up any notes you've made, including the person's name and other details. You'll appear to be the master of your social circle. They may also be able to feed you info from the Internet. They're being developed by Tokyo University, which just showed off a prototype.

And oh yeah, they're also being marketed as a way to keep track of your keys, cell phone and other crap that you lose track of. They'll learn to recognize those objects of yours, and then store in their memory when they last saw your keys. In theory, you'll never lose things again. But the potential for easing — and possibly magnifying, if someone else puts on your goggles — social awkwardness. [Register Hardware and InventorSpot]



posted at: 15:58 | path: /tech | permanent link to this entry

The Massive Solar-Orbiting Electro-Mechanical Analytic Engine, Mark 6 [Concept Art]
src

In some circles of the steampunk Star Wars universe this is known as the "Death Star," and it generates billions of calculations all day long in an effort to work with Arcane Mathematics and find a "Unified Force Theory" that can destroy entire planets.

Artist Eric Poulton has put together a series of pieces that reimagine Star Wars in a steampunk setting, and the coolest piece is probably this Engine/Death Star. Poulton says:

Inside is kilometer after kilometer of tubes and wheels, cranks and gears, all spinning and clacking, spitting out an endless series of numbers for the Imperials scientists to decipher.
It sure looks a lot more threatening than the real thing, and just knowing it could potentially kill you with the power of math is a bit offsetting. Poulton has also worked on a total conversion steampunk mod for Unreal Tournament called "Clockwork Cannons," and lends his art to videogames for his day job.



posted at: 15:56 | path: /starwars | permanent link to this entry

The Victorian-Era Supercomputer And The Genius Who Created It [Triviagasm]
src

The London Science Museum finally completed work on the Victorian era's greatest supercomputer, the Difference Engine No. 2, 120 years after the death of inventor Charles Babbage. This five-ton machine is currently traveling across the pond to San Francisco, and will go on display in America for the first time starting May 10th at the Computer History Museum. Find out everything you wanted to know about Charles Babbage and his wonderful engines in today's triviagasm.

  • Babbage had a life-threatening fever when he was 8 years old, and the parents ordered that his "brain was not to be taxed too much." Babbage later thought that this left him free to daydream, which led to his computers.
  • Babbage was later schooled at the Holmwood Academy, which only had 30 students. They also had a massive library, with many books focused on mathematics, which he fell in love with.
  • He worked on calculating machine designs from other inventor/mathematicians like Blaise Pascal, Wilhelm Schickard, and Gottfried Leibniz. All of these men had designed working calculators from the 1500s on. In Shickard's case, he had invented a calculating machine called "The Speeding Clock" that could work with six-digit numbers and would ring a bell to indicate memory overflow. It was later destroyed in a fire, but a working replica was constructed in 1960.
  • Babbage himself first proposed building a "calculating engine" with much more capacity in 1822, and he went on to design several machines which he called "Difference Engines." Sadly, they were never built because of their enormous size, cost, and also because Babbage's personality frequently clashed with investors. Also, in 1827, Babbage's father, wife, and two of his sons died... all in the same year. He had a resulting mental breakdown which further delayed any construction or design.
  • The first Difference Engine design had over 25,000 parts, would have been eight feet high, and would have weighed 15 tons. It was never fully completed during his lifetime, although different sections were later assembled and shown to work by his son, Henry Provost Babbage, after he inherited them.
  • Babbage revised his designs for the Difference Engine No. 2, although this was never built during his lifetime either. In 1989, the London Science Museum began constructing one from his designs, and it was completed in 1991. It has 8,000 parts of bronze, cast iron and steel, weighs five tons and measures eleven feet long and seven feet high.
  • Only two versions of this Engine exist: the one built for the London Science Museum, and a second one that was built by the museum on special commission for millionaire Nathan Myhrvold.
  • The first completed Difference Engine No. 2 performed its first calculation in 1991, and returned results to more than 31 digits. That's more than your souped-up pocket calculator.
  • A separate printing unit that Babbage designed was constructed for the Engine in 2000 and didn't need USB a to b cables or a serial interface. Pretty fancy stuff for the 19th Century.
  • Babbage improved on his Difference Engine ideas again by working on plans for an Analytical Engine that could be reprogrammed by inserting programs on punch cards into the machine. This was the first programmable computer, which later led to other scientists improving on these ideas and eventually to the modern computer.
  • Besides working on engines and calculating machines, Babbage also served as a mathematics professor at Cambridge for many years, won a Gold Medal from the Royal Astronomical Society, working on railroad rail gauges, invented uniform postal rates, ran for Parliament, worked in cryptography, and also invented the "pilot" (better known as a cow-catcher) that was mounted on the front of locomotives to "push" cows off the tracks to help prevent derailings.
  • Babbage also didn't suffer from what he called public nuisance very well, either. He published "Observations of Street Nuisances" in 1864, which was a summary of 165 nuisances that he observed over 80 days. He also wrote "Table of the Relative Frequency of the Causes of Breakage of Plate Glass Windows" after counting the broken windows on a nearby factory.
  • On a side note, growing up in Dallas, Texas, I used to beg my parents to take me to a little software shop to buy computer games. It was called Babbage's. Today it's better known as GameStop, but I still have a soft spot for that geeky little store.
  • To this date, Charles Babbage's brain is preserved in a glass jar at the London Science Museum, just awaiting the perfect moment for reanimation.



posted at: 15:55 | path: /compsci | permanent link to this entry

A bridge with a nervous system
src

352144488_4a1dbec18c_m Is this a great idea for engineering, or a way to make our toasters self-aware and kill us all?

Researchers want to build in to bridges, airplanes, and other large structures a type of nervous system that, among other things, would detect any defects such as cracks or rust, and relay that to a central computer that could tell engineers and repair workers what needed to be fixed.  This Structural Health Monitoring (SMH) system would use ultrasound waves travelling through really teeny, tiny fibers embedded into the material to detect any potential dangers.  After the recent airline maintenance scandal in the US, this could really be useful.

(Note: I also came across this book from a conference in Tokyo in 2003 on the same topic for you eggheads who really want to get into this.  Forgive me if I don’t read all 1300 pages of engineering articles)

(via Scitechdaily) (image from massdistraction)


Related posts



posted at: 15:52 | path: /tech | permanent link to this entry

Sailing, sailing, over the bounding interplanetary main
src

solar sailI’ve always loved the idea of the solar sail, giant glistening sails that use solar radiation to propel a ship through the solar system (as in the image at left).

But the Finnish Meterological Institute has come up with a better way to utilize that radiation for spacecraft propulsion, “by using long metallic tethers and a solar-powered electron gun to create an ‘electric sail.’” (Via Gizmag.)

Invented in 2006 at the Kumpula Space Centre, the electric solar wind sail, alas, loses some of the romance of the traditional solar sail: it looks more like an antenna (view an animation here):

A full-scale version would consist of up to 100 thin conducting wires as long as 20 km that are kept in a high positive potential by the spacecraft’s on-board solar-powered electron gun. This electric field effectively turns the wires into 50 meter wide sails that can then make use of solar wind. It’s estimated that a 20km long electric sail wire (which weighs only a few hundred grams and fits in a small reel) is equivalent to a one square kilometer solar wind sail when deployed in this way.

Planning for a test mission has begun, and the researchers note that the same technology could also assist in the development of solar power satellites.

In 2004 NASA’s Solar Sail Propulsion Team successfully deployed two 10-meter solar sails made of reflective material 40 to 100 times thinner than a piece of writing paper in a laboratory vacuum environment. But the first solar sail spacecraft, Cosmos 1, failed to enter orbit after its 2005 launch.  (UPDATE: Not, as commentator Anthony points out, due to any fault of the solar sails, but due to a rocket booster failure.)

(Image: John Ballentine.)


Related posts



posted at: 15:51 | path: /astrotech | permanent link to this entry

Meat futures redux - just leave the brains out
src

BullThe best thing about science is the same as the best thing about science fiction - it’s the lively debates and differing opinions. The vat-grown meat story got some fairly wide coverage beyond science fictional circles, so here’s legendary biology-blogger PZ “Pharyngula” Myers’ angle on the issue:

“The more I think about it, the more I think people are going at it backwards. We shouldn’t be thinking about building muscle from the cells up, to create a purified system to produce meat for the market, we should be going the other way, starting with self-sustaining meat producers and genetically paring away the less commercially viable bits, like the brain. Instead of test-tube meat, we should be working on more efficient organisms that generate muscle tissue with the properties we want.”

OK, now I’m fairly easy with the idea of eating meat that’s just a lump of stuff grown in a petri-dish. But animals engineered to not have a nervous sytem? That really is a pretty queasy thought, even though I can see why (rationally) it shouldn’t be. [image by TwoBlueDay]


Related posts



posted at: 15:51 | path: /sci/bio | permanent link to this entry

Uncrashable cars…and one that definitely isn’t
src

Uncrashable Car graphic “Uncrashable” cars are the long-term promise of the largest road safety research project ever launched in Europe (Via Science Daily):

A truck exits suddenly from a side road, directly into your lane only dozens of metres ahead. Suddenly, your car issues a warning, starts applying the brakes and attempts to take evasive action. Realising impact is unavoidable; in-car safety systems pre-tension the safety belts and arm the airbag, timing its release to the second before impact.

The research project, called PReVENT, has 56 partners and a budget of more than €50 million, and it’s main focus is on relatively cheap and simple technologies like parking sensors and satellite navigation that can be adapted to enhance safety, but some of the more experimental systems being studied in some of its sub-projects, with catchy names like WILLWARN (which uses wireless communication with other vehicles to alert drivers about potentially dangerous situations), LATERALSAFE (which uses active sensing to eliminate the dangers of the blind spot) and COMPOSE, which can automatically brake if a pedestrian steps onto the road, or extend the bumper and raise the hood to keep occupants safer.

Some of these technologies could start to show up on cars within just a few years’ time. (Image: PReVENT.)

North American Eagle If, on the other hand, the idea of an uncrashable car somehow takes all the fun out of driving for you, you might want to follow up on this lead (Times Online via Gizmodo):

Are you fearless? Do you have razor-sharp reactions and the sponsor-friendly good looks of a young Robert Redford? Think you’ve got what it takes to drive a supersonic jet car at speeds of more than 800mph?

If so, you might be just the man (or woman) to take the wheel of the North American Eagle, a 42,500bhp jet car with everything it takes to smash the land speed record, says its maker, except one thing – a driver.

Last week the team behind a joint American-Canadian attempt to win the world record back from the British launched an open contest to find that person.

Read more about the team here, then send a 400-word e-mail listing your credentials and a photo of yourself to landspeedracing@gmail.com.

Tell ‘em Futurismic sent you. (Image: landspeed.com.)


Related posts



posted at: 15:50 | path: /tech | permanent link to this entry

Friday Free Fiction for 18th April
src

Here we go again with your weekly round-up of free fiction on the web …

***

From Manybooks.net:

  • Space Platform” by Murray Leinster (”When young Joe Kenmore came to Bootstrap to install pilot gyros in the Platform he hadn’t bargained for sabotage or murder or love. But Joe learned that ruthless agents were determined to wreck the project. He found that the beautiful girl he loved, and men like The Chief, a rugged Indian steelworker, and Mike, a midget who made up for his size by brains, would have to fight with their bare hands to make man’s age old dream of space travel come true!” Can you fight political disinterest with your bare hands, then?)
  • The Penal Cluster” by Gordon Randall Garrett (”Tomorrow’s technocracy will produce more and more things for better living. It will produce other things, also; among them, criminals too despicable to live on this earth. Too abominable to breathe our free air.” O NOES!)
  • The Planet Strappers” by Raymond Z Gallun (”The Planet Strappers started out as The Bunch, a group of student-astronauts in the back room of a store in Jarviston, Minnesota. They wanted off Earth, and they begged, borrowed and built what they needed to make it. They got what they wanted - a start on the road to the stars - but no one brought up on Earth could have imagined what was waiting for them Out There!” No kidding, they have Starbucks here too?)
  • Trouble on Titan” by Arthur K Barnes (”When the Queen of the Spaceways meets the King of the Interplanetary Wilds, there’s a checkmate in the stalking of Saturn’s most dangerous game!”)
  • The Delegate From Venus” by Henry Slesar (”Everybody was waiting to see what the delegate from Venus looked like. And all they got for their patience was the biggest surprise since David clobbered Goliath.”)
  • No Moving Parts” by Murray F Yaco

***

News from Small Beer Press:

“To celebrate the publication of his first new collection of short stories in ten years, The Baum Plan for Financial Independence and Other Stories, John Kessel and Small Beer Press have made it available as a free download in various completely open formats with no Digital Rights Management (DRM) strings attached. An astonishing, long-awaited collection of stories that intersect imaginatively with Pride and Prejudice, Frankenstein, The Wizard of Oz, and Flannery O’Connor. Includes John Kessel’s modern classic “Lunar Quartet” sequence about life on the moon.”

Sounds good to me.

***

Two updates from John Joseph Adams from beneath his F&SF hat. Firstly there’s news about Daryl Gregory:

“Daryl’s website features a number of pieces of free fiction, including several F&SF stories - such as his first pro sale, “In the Wheels,” “The Continuing Adventures of Rocket Boy,” and “Free, and Clear.”"

And then some news about Peter Beagle:

Peter S. Beagle is the author of many novels and stories, including the beloved classic The Last Unicorn. In 2005, F&SF published Beagle’s Nebula Award-winning sequel to The Last Unicorn, the novelette “Two Hearts”.”

I adored the movie of The Last Unicorn as a child (I can still get surprisingly emotional over it now), and I was gutted when I found out how badly shafted Beagle was on the deal. Go read his story.

***

The gang at Subterranean Press are churning out the Spring 2008 issue of Subterranean Online. Available so far:

***

An email arrived from Nathan Lilly:

“Just a brief note to announce SpaceWesterns.com’s first full year of publication. The new year brings:

  • a creative refresh of the home page
  • the launch of our blog, The Sideshow
  • the creation of a (nearly) complete Space Western list.

All that in addition to the publication of Space Western stories and articles. This week we’ve [re-]published “Craphound” by Cory Doctorow, and part 1 of an eight-part serial titled “A Man Called Mister Brown” by A.R. Yngve. Next week we have an interview with David Weddle, screenwriter for Battlestar Galactica.”

Sounds like it’s all go over there - good luck, Nathan!

***

The still-websiteless-but-eternally-diligent-and-superbly-monickered Cole Kitchen continues to keep us abreast of webzine developments:

  • Helix SF has recently published Issue #8 for Spring 2008
  • Abyss & Apex has done the same with their twenty-fifth issue.

Also a couple of new titles (now added to the Sidebar Of Justice)

  • RevolutionSF (tag-lined “Tough Love for Sci-Fi” … there’s no tougher love than that horrible contraction, surely? ;) )
  • Bewildering Stories (which, once you get past the bewildering pre-millennial web-design, appears to have a great deal of content stored away)

Cheers, Cole!

***

Shadow Unit is up to episode 5 with “Ballistic“, a team effort from Sarah Monette, Emma Bull, Elizabeth Bear & Amanda Downum.

“You aren’t supposed to be in Grandma’s room when she isn’t there. It’s dark inside, the heavy curtains drawn tight, and the air smells of camphor and lavender potpourri and furniture polish. Your stomach feels too small as you peer through the cracked-open door, like it did when Tommy Wilson dared you to crawl into that abandoned woodshed all full of spiders. Making Grandma mad scares you more than spiders, but this morning she went to the store and left you alone watching cartoons and eating Cocoa Puffs.”

***

Jayme Lynn Blaschke has the tenth instalment of the irregular yet intriguing “Memory”.

“Chaos erupted among the moironteau. The predatory discipline organizing the creatures broke down in the face of thirty quarry. Moironteau lunged and slashed, footheads choming wildly at the darting green Parrics flying to and fro. Those hanging above dropped into the fray, the lure of the chase too tempting to resist. The carefully-constructed trap collapsed into itself.

“Stupiding otherwhereians,” muttered Parric from his coiled position in the middle of it all. “All muscle, no finessing.”"

***

Sir John of Scalzi is getting all DOS-prompt-retro on us by going the shareware route with a piece of fiction:

“Starting right this very second, a (zipped) pdf version of “How I Proposed to My Wife: An Alien Sex Story” is available for you to read and enjoy. I’m offering it as shareware - that is, it’s free to read, but if you like it, you’re encouraged to send a little money my way. How much? Up to you (but, you know. Not too much. It’s a short story, not a novel).”

***

Via SFCanada, we hear that Nina Munteanu has posted her short story “A Butterfly in Peking” online.

***

Jay Lake dips into his seemingly bottomless pit of previously published short fiction once again:

“The current installment in this series is my short story “Small Magic“. At 5,600 words, this originally appeared in Weird Tales #340 (May/June 2006). It has never been reprinted elsewhere. If you like the story, please consider supporting Weird Tales. Trivium: the initial inspiration for this story was the Sting song “All This Time”.)”

***

The Friday Flash Fictioneers are back in action once again - though yours truly is using double shifts at the day-job as his cop-out excuse once again.

***

A final non-fiction bonus - and if Futurismic has any creationist readers, they may wish to skip ahead right over this one. Via Cosmos Magazine, we hear that the complete collection of Charles Darwin’s papers are online. SRSLY - all of them:

“”This release makes his private papers, mountains of notes, experiments and research behind his world-changing publications available to the world for free,” said John van Wyhe, the director of The Complete Work of Charles Darwin Online project.”

Blimey.

***

Well, that’s your lot for this week - there should be more than enough there to keep you busy over the weekend, I figure. Don’t forget that we’re always looking for tip-offs and plugs from you, our readers, so just drop us a line via the contact page.

In the meantime - have a great weekend, folks!


Related posts



posted at: 15:49 | path: /scifi | permanent link to this entry

The Quantum Network
src

Researchers have built a quantum logic gate in an optical fiber, laying the foundation for a quantum computer network. [+]



posted at: 15:48 | path: /sci/physics | permanent link to this entry

Soekris laser guided squirrel trap
src

Filed under:


Got a bit of a pest problem? [Chad] built a better squirrel/rabbit/thing trap using a soekris box, a laser pointer, serial controlled relay and a small motor. When the laser beam is broken, the Soekris activates the relay, pulling the door pins. Then it take a picture with a webcam and send him a page.
Read | Permalink | Email this | Linking Blogs | Comments


posted at: 15:46 | path: /lasers | permanent link to this entry

DIY Midi pedalboard
src

Filed under:


[Nick] sent in this sweet midi pedal organ. [Seffan] modded an old set of organ pedals with the cheapest midi keyboard he could find. Each pedal was equipped with a switch mechanism, so it was just a matter of patience and wiring. To come up with enough wire for the job, he sacrificed some IDE cables. If you've ever played with some organ pedals, you know that these things can really add another dimension to music - especially with the newly added MIDI interface.
Read | Permalink | Email this | Linking Blogs | Comments


posted at: 15:45 | path: /music | permanent link to this entry

Autonomous Catamaran
src

Filed under: ,


[Gabriel] put together an impressive writeup of his autonomous catamaran, Atlantis(PDF). It was certainly done as an academic project, but there's a thorough explanation of the math logic behind the control systems. The heart of the boat was a waterproofed Pentium laptop with a CAN bus parallel interface used to talk to everything on-board. Sensors included GPS, wind, hull speed and rudder angle. In case the site can't handle the load, I've mirrored the 1.4MB PDF here.
Permalink | Email this | Linking Blogs | Comments


posted at: 15:45 | path: /vehicles | permanent link to this entry

Bruteforcing a macroscale self-replicating machine
As part of the strategy towards achieving exponential growth, I am also focusing on the bio side of things. I have yet to do a formal writeup of my bio strategies for controlling exponential growth, directed selection, etc., but I think that this quote summarizes things nicely:

http://ellingtonlab.org/ 'My research focuses on using evolutionary techniques to engineer cells ... we have largely used automated evolutionary engineering to effect these changes [and] we are increasingly relying upon bioinformatics, modeling, and rational design to accelerate evolutionary processes.'

Automated evolutionary engineering for the acceleration of evolutionary processes.

posted at: 15:28 | path: | permanent link to this entry

Thu, 17 Apr 2008

Local wiki newsdump (2008-04-17)



posted at: 19:34 | path: | permanent link to this entry

Metarepository and societal knowledge database
Recently one of my projects with Ben Lipkowitz involves 'skdb', macroscale kinematic self-replicating machines, and you can see a description of it over here in the last paragraph on that page at the moment (#3). The idea is to use a metarepository much like APT for software packages except more broadly for open-source manufacturing knowledge in order to brute force the development of a nonbiological, programmable self-replicating machine of the likes that Freitas, Drexler, Merkle, von Neumann and many others have been interested in. See also OSCOMAK - the Open Source Community on Open Source Manufacturing Knowledge, RepRap, and my recent Slashdot post on self-replicating machinery. Bruteforcing is one of the tactics that I have been investigating as opposed to relying on biology. I am also interested in the prospects of a solid state piezoelectric effect + field effect combination on a self-replicating scanning-probe-lithography setup, which might need some computational physics simulations. Ask for the current ADR file of bookmarks if you're interested in seeing all of the packages I know about re: physics simulation. I was talking with Jimmy Stewart over Skype a few days ago on this topic.

posted at: 19:27 | path: | permanent link to this entry

Allan Synder and DIY rTMS to induce savantism
Allan Synder page; on the extropy-chat mailing list, Damien Broderick corrected my naming of Allan, oops. The idea is that rTMS setups - such as the open-rTMS project - can turn parts of your brain on and off with the flick of a switch and some powerful electromagnets and so on.

posted at: 18:59 | path: /sci/bio | permanent link to this entry

Sat, 12 Apr 2008

SNPedia man page
src

At present SNPedia contains 1475 snps. The bulk of these are recent arrivals mined from OMIM and GeneRIF. But it all started with about 200 hand curated from pubmed searches, journals and news articles. These older snp pages tend to have accumulated the most information. Newer ones sorely need that sort of attention.

I foresee 2 audiences who can be served by SNPedia. The first audience is researchers who are actively trying to determine the effects of genomic variations. Often they've come here after googling for an rs#. For these people SNPedia may be a useful wiki portal to primary sources, a collective lab notebook, and a chat room. Linking to your own papers is welcome.

The second audience is people who know aspects of their own genome. A very public example is Jim Watson, who recently released his genome. Craig Venter's genome should be public 'any day now', and Esther Dyson seems to want to be next. Given the numerous testing options, it is safe to assume that there are others who already know aspects of their genome. More public and private genomes will surely follow.

But what does it mean to know some or all of your genome? Jim Waston was given a 'fasta' formatted text file.
It looked sort of like this:

>WATSON chromosome 1
GTACGTATGCATGTTGGTGTGCAATATATTATGGCTGAGAGTCAGTCAGTCGATCTGACGTATGC
TAGCAGTCTACGTAGCTAGCTAGCATGCTACGATGCGGGGAGCATATTGATCTGATCGATCGTAG
ATCGATGCAGCTACGAT...

Except it has a an extra 6 billion As, Ts, Cs, and Gs. Its too big to fit on a DVD, and it doesn't come with a manual. How can you begin make sense of all that? Lincoln Stein at CSHL put together this viewer. Thats a good start, but it's specific to Watson, and designed for asking particular questions.

SNPedia = SNP + wikipedia

Technically, a SNP is a Single Nucleotide Polymorphism. It means that a position in the dna was changed. I (ab)use the term 'snp' to mean a 'Small' Nucleotide Polymorphism. This encompasses changing a few neighboring letters, or inserting or deleting a few extras. If a snp changed the A at position 7 into a T the previous example would now look like this:

>WATSON chromosome 1 with an A>T snp at position 7
GTACGTTTGC...

>WATSON chromosome 1 with an AA insertion at position 7
GTACGTAAATGC...

The NCBI has been cataloging all of these snps in dbSNP. It's a great resource, and most importantly it is assigning a unique, stable and consistent name to each snp. These names look like rs7903146. That is the letters 'rs' followed by a some digits. The snp is defined by having a certain pattern of letters 'upstream' of the change, a small variant, and a fixed 'downstream'.

Let's make this a bit more concrete. While the site always feels a bit slow for me,
http://www.ensembl.org/Homo_sapiens/snpview?source=dbSNP;snp=rs7903146
if you start at ensembl you can see the actual pattern of DNA for this snp.

In the field 'Flanking sequence' you will see a large chunk of dna, with a single red letter Y in the middle. A bit above that we are told

C/T (ambiguity code: Y)
Ancestral allele: T

We get two copies of dna -- one from mom, one from dad. All distant ancestors had this pattern of DNA with the T in the middle of both copies. A child was born with a mutation which changed it from a T to a C. This child lived to pass it on and it has continued to pass on for many generations.

Depending on which you got from each parent, at rs7903146 your dna is one of these 3 genotypes. (C;C) or (C;T) or (T;T).

Over at the NCBI page, you can see some primary data about the frequency of each of these in different populations.
http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=7903146#Diversity
Among Chinese and Japanese, 95% of the people were (C;C). But among a Utah population of mixed european ancestry 33% were (C;T). And 8.3% were (T;T).

James Watson turns out to be a (C;T) as well.
http://jimwatsonsequence.cshl.edu/cgi-perl/gbrowse/jwsequence/?name=SNP%3Ars7903146
I'm currently in a bidding war with Science vs Nature for my paper proving that James Watson is not asian.

Surely google knows all.
http://www.google.com/search?hl=en&q=rs7903146
As I write this the top hit is a recent paper reporting "TCF7L2 rs7903146 variant does not associate with smallness for gestational age in the French population". Is that really the most important thing about this snp?

Google's second hit is on SNPedia
http://www.snpedia.com/index.php?ti