As recommended by Andy Ellington over at UT Austin, these are my notes on genetic circuit design, which, as of 2008-02-25, is a completely unheard of term, except perhaps in the sense of Weiss and in the sense of 'circuits' from electronics, although it is likely that this interpretation is incorrect.

2008-02-25 zip (35 MB of PDFs)


2008-02-26 -- starting with Design of gene circuits - lessons from bacteria - Wall.pdf

Operon model of Jacob and Monod
transcriptional repression
transcriptional activation
cDNA microarrays (DNA microarrays @ biohackwiki)
-- Ref: Khodursky, A. B. et al. DNA microarray analysis of gene expression in response to physiological and genetic changes that affect tryptophan metabolism in Escherichia coli. Proc. Natl Acad. Sci. USA 97, 12170-12175 (2000).
-- Ref: Martin, R. G & Rosner, J. L. Genomics of the marA/soxS/rb regulon of Escherichia coli: identification of directly activated promoters by application of molecular genetics and informatics to microarray data. Mol. Microbiol. 44, 1611-1624 (2002).

TFs == transcription factors
in vivo fluorescent reporter systems
The lactose system (lacI-lacZYA) in E. coli (ref 31) induces lactose catabolism in response to the signal allactose, a catabolic intermediate. The circuit is expected to maintain a stationary basal level of beta-galactosidase (the lacZ gene product) in the absence of allolactose, to dynamically increase the expression level when the level of allolactose increases, and to maintain a higher, stationary level of expression in the presence of a stationary, inducing level of allolactose. The circuit function requires both the basal and induced states to be stabal. If the circuit is to operate in a variety of environments, the function must be robust to environmental changes. If the organism must act quickly to make use of metabolites, catabolism needs to be induced quickly in response to the signal. (catabolic gene circuit -- see also the ecoli tryptophan system trpR-trpLEDCBA).
Design principles for the molecular mode of gene control, signal connectivity and regulation of TF expression
regulation of the lac operon
transcriptional attenuation


From the Wall paper on design of gene circuits (lessons from bacteria), there are two types of elementary gene circuits: (1) inducible-catabolic and (2) repressible-biosynthetic circuits. What are the principles of the selection of gene circuit designs in different contexts, and why? There are at least three types of signalers in catabolic (building) gene circuits, such as (1) an encoded substrate, (2) intermediate byproduct in the pathway, (3) the environment (some external signaler) and (4) random noise (perhaps due to a lack of robust design of the circuit via its natural selection).

inducible circuits - where effector expression increases a signaler (perhaps a metabolite). Find three examples of inducible circuits.
repressible circuits - where effector expression decreases given a signaler.
Catabolic gene circuits tend to be induced by a metabolic intermediate. Biosynthetic gene circuits tend to be repressed by a metabolic end product when synthesis of biosynthetic enzymes would be wasteful.

A signaler can bring about different patterns of coupling of regulator and effector gene expression, such as (1) direct coupling, (2) inverse coupling, (3) uncoupling.

TFs autoregulate themselves (autogenous regulation, autoregulation). "Just as effector gene expression might be under activator control or repressor control, regulator gene expression might be under activator control (which yields positive autoregulation), repressor control (which yields negative autoregulation) or it might be unaffected by the TF. For example, among inducible circuits in ecoli, dsdC-dsdXA shows direct coupling, cynR-cynSX shows uncoupling and metR-metE shows inverse coupling. Among repressible circuitsi n ecoli, trpR-trpLEDCBA shows direct coupling and tyR-(aroF-tyrA) shows uncoupling. All of these circuits show negative autoregulation. TF is not autoregulating in those cases."

The demand theory of the molecular mode of gene control basically states that the two elementary types of gene circuits (inducible and repressible) have opposite requirements for effector activity (an inducible circuit needs high levels of effectors (activators), while a repressible circuit needs low levels of effector molecules, since low levels of effector molecules represses the concentration of the signaler). And any mutation would result in drastic evolutionary disadvantage. The names of the elementary circuits matter, in other words.




2008-02-28. Circuit idea: control the expression of oxytocin (C43H66N12O12S2, (carboxymethyl)-4-(2-(1-(carboxymethylamino)-5- guanidino-1-oxopentan-2-ylcarbamoyl) pyrrolidine-1-carbonyl)-16-(4-hydroxybenzyl)- 6,9,12,15,18-pentaoxo-1,2-dithia-5,8,11,14,17- pentaazacycloicosan-10-yl)propanoic acid, PubChem ID 439302) in wall fungi.
OXT sequencing information can be found in entrez.

There are two proteins encoded by this gene, oxytocin and neurophysin I. Oxytocin is posterior pituitary hormone which is synthesized as an inactive precursor in the hypothalamus along with its carrier protein neurophysin I. Together with neurophysin, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis, where it is either stored or secreted into the bloodstream. The precursor seems to be activated while it is being transported along the axon to the posterior pituitary. This hormone contracts smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation and complex sexual and maternal behaviour, as well as in the regulation of water excretion and cardiovascular functions. FASTA format:

>ref|NC_000020.9|NC_000020:3000266-3001162 Homo sapiens chromosome 20, reference assembly, complete sequence
ACCAGTCACGGACCCTGGACCCAGCGCACCCGCACCATGGCCGGCCCCAGCCTCGCTTGCTGTCTGCTCG GCCTCCTGGCGCTGACCTCCGCCTGCTACATCCAGAACTGCCCCCTGGGAGGCAAGAGGGCCGCGCCGGA CCTCGACGTGCGCAAGGTGAGTCCCCAGCCCTGGTCCCGCGGCGCTCCGGGGAGGGAGGGACCCGCAGCC ACAGGGGCGCGCCCCGCTCCGGCCTCGCCTGAGAACTCCAGGAGCTGAGCGGATTTTGACGCCCCGCCCT TGACCGCGGTCGAGGCCCCCACGGCGCCCCAGCGCGTCTCAGCCCCGCTGTCCCGCCCGAACTCCGAACC CCGGACCCCAGCATCCTTGCCCGGCGCACCCCGGCCGGCCTCGCAGGGTCCTCCGAGCGAGTCCCCAGCG CCGCCCCGGCTCCCGCTCACCCCGCCCGTCCCCGCAGTGCCTCCCCTGCGGCCCCGGGGGCAAAGGCCGC TGCTTCGGGCCCAATATCTGCTGCGCGGAAGAGCTGGGCTGCTTCGTGGGCACCGCCGAAGCGCTGCGCT GCCAGGAGGAGAACTACCTGCCGTCGCCCTGCCAGTCCGGCCAGAAGGCGTGCGGGAGCGGGGGCCGCTG CGCGGTCTTGGGCCTCTGCTGCAGCCCGGGTGAGCGGGGCAAGGCGCTCCGGGGCCAGGGGGAGGCGGGC GGGGGTGCGGCCGGGATTCCCCTGACTCCACCTCTTCCTCCAGACGGCTGCCACGCCGACCCTGCCTGCG ACGCGGAAGCCACCTTCTCCCAGCGCTGAAACTTGATGGCTCCGAACACCCTCGAAGCGCGCCACTCGCT TCCCCCATAGCCACCCCAGAAATGGTGAAAATAAAATAAAGCAGGTTTTTCTCCTCT
To regulate the expression of oxytocin, are riboswitches required? There's the P(lac) repressible regulator (tggtgcaaaacctttcgcggtatggcatgatagcgcc) (see the Wikipedia lac operon article). So here's the preliminary plan:

The oxytocin regulatory circuit DNA sequence (green means optional)--
ATGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTT CCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGA GCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCC ACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGG GTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCT TCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAA GCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTT TCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCT GTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGC AATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGC AAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAAT GCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAA GACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCG TGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGT GAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAA TGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGGCTGCAAACGACGAAAACTACGCTTTAGT AGCTTAATAAAATTGTGAGCGGATAACAATTGACATTGTGAGCGGATAACAAGATACTGAGCACAACCA GTCACGGACCCTGGACCCAGCGCACCCGCACCATGGCCGGCCCCAGCCTCGCTTGCTGTCTGCTCGGCCT CCTGGCGCTGACCTCCGCCTGCTACATCCAGAACTGCCCCCTGGGAGGCAAGAGGGCCGCGCCGGACCTC GACGTGCGCAAGGTGAGTCCCCAGCCCTGGTCCCGCGGCGCTCCGGGGAGGGAGGGACCCGCAGCCACAG GGGCGCGCCCCGCTCCGGCCTCGCCTGAGAACTCCAGGAGCTGAGCGGATTTTGACGCCCCGCCCTTGAC CGCGGTCGAGGCCCCCACGGCGCCCCAGCGCGTCTCAGCCCCGCTGTCCCGCCCGAACTCCGAACCCCGG ACCCCAGCATCCTTGCCCGGCGCACCCCGGCCGGCCTCGCAGGGTCCTCCGAGCGAGTCCCCAGCGCCGC CCCGGCTCCCGCTCACCCCGCCCGTCCCCGCAGTGCCTCCCCTGCGGCCCCGGGGGCAAAGGCCGCTGCT TCGGGCCCAATATCTGCTGCGCGGAAGAGCTGGGCTGCTTCGTGGGCACCGCCGAAGCGCTGCGCTGCCA GGAGGAGAACTACCTGCCGTCGCCCTGCCAGTCCGGCCAGAAGGCGTGCGGGAGCGGGGGCCGCTGCGCG GTCTTGGGCCTCTGCTGCAGCCCGGGTGAGCGGGGCAAGGCGCTCCGGGGCCAGGGGGAGGCGGGCGGGG GTGCGGCCGGGATTCCCCTGACTCCACCTCTTCCTCCAGACGGCTGCCACGCCGACCCTGCCTGCGACGC GGAAGCCACCTTCTCCCAGCGCTGAAACTTGATGGCTCCGAACACCCTCGAAGCGCGCCACTCGCTTCCC CCATAGCCACCCCAGAAATGGTGAAAATAAAATAAAGCAGGTTTTTCTCCTCT


BBa_C0012(1128 bp), the lacl repressor, is inhibited in the presence of lactose. And without lactose, it inhibits the lac promoter downstream (possibly hundreds of bp in distance). Part-only sequence for BBa_R0011(55 bp) promoter (lacl-regulated, on in sequences without lacl repressor and medium in sequences with the lacl repressor).



John Eargle expressed concern during review of the final construct -- in particular, NCBI entrez says that the oxytocin sequence I selected is a precursor that is later further processed by neuroventricles, the final sequence supposedly being defined by positions 20-28 (in the amino acid (aa) seq --- which was defined as "c yiqncplg"). To account for this case, a second gene can be thrown in with a gal or trp operon/promoter, which wouldn't add much to the overall nt seq length, allowing for a "one-time run" if testing was to take place.

For future notes -- write a tutorial on "How to design a genetic circuit" (or at least the basics) --- should be simple enough to mention ways of controlling circuits and so on. This would include mentioning the important biodatabases, the entrez project, metabase (and their list of databases), etc.